Transcript: Mouse XM_006513739.3

PREDICTED: Mus musculus RIKEN cDNA A230046K03 gene (A230046K03Rik), transcript variant X4, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Washc4 (319277)
Length:
5053
CDS:
622..2907

Additional Resources:

NCBI RefSeq record:
XM_006513739.3
NBCI Gene record:
Washc4 (319277)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006513739.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000283539 CGCGCTGTCTTCCCGATTTAT pLKO_005 1213 CDS 100% 15.000 21.000 N Washc4 n/a
2 TRCN0000267694 GGTATGCTAGCTGATAGTTAA pLKO_005 3879 3UTR 100% 13.200 18.480 N Washc4 n/a
3 TRCN0000144476 CGAAGGCCAAAGAATATACAT pLKO.1 2392 CDS 100% 5.625 7.875 N WASHC4 n/a
4 TRCN0000319285 CGAAGGCCAAAGAATATACAT pLKO_005 2392 CDS 100% 5.625 7.875 N WASHC4 n/a
5 TRCN0000267751 GAATATACATCTCCGAAATTT pLKO_005 2403 CDS 100% 15.000 10.500 N Washc4 n/a
6 TRCN0000267752 GGTAATGCTATGGGCTATATA pLKO_005 2143 CDS 100% 15.000 10.500 N Washc4 n/a
7 TRCN0000283540 GAAGCGACTGGAGGTCTATTT pLKO_005 2715 CDS 100% 13.200 9.240 N Washc4 n/a
8 TRCN0000182745 CCAGAGTTCAAATCCCAGCAA pLKO.1 4607 3UTR 100% 2.640 1.320 Y P3h3 n/a
9 TRCN0000320070 CCAGAGTTCAAATCCCAGCAA pLKO_005 4607 3UTR 100% 2.640 1.320 Y P3h3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006513739.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.