Transcript: Mouse XM_006513883.4

PREDICTED: Mus musculus E2F transcription factor 7 (E2f7), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Mus musculus (mouse)
Gene:
E2f7 (52679)
Length:
5907
CDS:
778..3372

Additional Resources:

NCBI RefSeq record:
XM_006513883.4
NBCI Gene record:
E2f7 (52679)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006513883.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000421938 GAATGGTCCAAGCGGACAAGT pLKO_005 2187 CDS 100% 4.950 6.930 N E2f7 n/a
2 TRCN0000084664 CGACCTGTCAAAGCAAAGAAT pLKO.1 813 CDS 100% 5.625 4.500 N E2f7 n/a
3 TRCN0000017456 CGGGTGGCTAAGAATCAGTAT pLKO.1 1261 CDS 100% 4.950 3.960 N E2F7 n/a
4 TRCN0000084665 CCTCCGACACAGAGAACTTAA pLKO.1 2231 CDS 100% 13.200 9.240 N E2f7 n/a
5 TRCN0000084663 GCACTTATTCTACAGCTTATT pLKO.1 3930 3UTR 100% 13.200 9.240 N E2f7 n/a
6 TRCN0000084666 AGGCTCTATGACATAGCCAAT pLKO.1 1660 CDS 100% 4.050 2.835 N E2f7 n/a
7 TRCN0000084667 AGTTCTCTATTCTCCCGCAAT pLKO.1 2910 CDS 100% 4.050 2.835 N E2f7 n/a
8 TRCN0000417968 CACCCAACTCTTCATGCTGTA pLKO_005 2295 CDS 100% 4.050 2.835 N E2f7 n/a
9 TRCN0000425017 TGTTGCTCAAACAGATTTGCC pLKO_005 2151 CDS 100% 2.640 1.848 N E2f7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006513883.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.