Transcript: Mouse XM_006513895.3

PREDICTED: Mus musculus plexin C1 (Plxnc1), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Plxnc1 (54712)
Length:
5851
CDS:
143..5401

Additional Resources:

NCBI RefSeq record:
XM_006513895.3
NBCI Gene record:
Plxnc1 (54712)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006513895.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000423391 GGCCACTATGAGATATCAAAT pLKO_005 4583 CDS 100% 13.200 18.480 N Plxnc1 n/a
2 TRCN0000078949 CCCTCTTCGATTCTGGGTAAA pLKO.1 4957 CDS 100% 10.800 15.120 N Plxnc1 n/a
3 TRCN0000078951 GCAGGTTTCTAGCTCCTAATT pLKO.1 3132 CDS 100% 13.200 10.560 N Plxnc1 n/a
4 TRCN0000437162 GCAGATGTCTGCCGGAATATT pLKO_005 4355 CDS 100% 15.000 10.500 N Plxnc1 n/a
5 TRCN0000413630 AGAAACTCTTCCGAAGCATTT pLKO_005 4812 CDS 100% 10.800 7.560 N Plxnc1 n/a
6 TRCN0000421301 AGGATATACCAACCTACAAAG pLKO_005 5133 CDS 100% 10.800 7.560 N Plxnc1 n/a
7 TRCN0000078950 CCCGTTACAAAGGTGCACTTT pLKO.1 2125 CDS 100% 4.950 3.465 N Plxnc1 n/a
8 TRCN0000078952 GTGGCATTAAATGTCGTCTTT pLKO.1 4310 CDS 100% 4.950 3.465 N Plxnc1 n/a
9 TRCN0000078948 CCCAGCTATAATGTCTTAGTT pLKO.1 2387 CDS 100% 5.625 3.375 N Plxnc1 n/a
10 TRCN0000060645 CCCTTCCTTGACTACAAACAT pLKO.1 3755 CDS 100% 5.625 3.375 N PLXNC1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006513895.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.