Transcript: Mouse XM_006513897.4

PREDICTED: Mus musculus methionine aminopeptidase 2 (Metap2), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Mus musculus (mouse)
Gene:
Metap2 (56307)
Length:
2559
CDS:
693..2129

Additional Resources:

NCBI RefSeq record:
XM_006513897.4
NBCI Gene record:
Metap2 (56307)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006513897.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000031798 CCTGTATCCTAATGGTGTATT pLKO.1 1058 CDS 100% 13.200 18.480 N Metap2 n/a
2 TRCN0000031794 GCTGTAAAGGATGCCACTAAT pLKO.1 1527 CDS 100% 13.200 18.480 N Metap2 n/a
3 TRCN0000031796 CCTGGGATGACGATGATAGAA pLKO.1 1257 CDS 100% 5.625 7.875 N Metap2 n/a
4 TRCN0000031797 CCAAGTGAAACCCATACGTAA pLKO.1 1652 CDS 100% 4.950 6.930 N Metap2 n/a
5 TRCN0000087604 CATATAGAATTCACGCTGGAA pLKO.1 1696 CDS 100% 0.000 0.000 N LOC384679 n/a
6 TRCN0000050580 CTTGGGAGAAAGTAAATACTT pLKO.1 1958 CDS 100% 5.625 4.500 N METAP2 n/a
7 TRCN0000087603 CCATTCAAGAAGTTATGGAAT pLKO.1 1600 CDS 100% 4.950 3.960 N LOC384679 n/a
8 TRCN0000087607 CCAATATGTGACCTGTATCCT pLKO.1 1047 CDS 100% 3.000 2.400 N LOC384679 n/a
9 TRCN0000087606 CGACATGGAATGTTCACACTA pLKO.1 1820 CDS 100% 4.950 3.465 N LOC384679 n/a
10 TRCN0000031795 CCCAAAGGACAAGAGTGTGAA pLKO.1 1080 CDS 100% 4.950 2.970 N Metap2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006513897.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.