Transcript: Mouse XM_006513992.2

PREDICTED: Mus musculus neurotensin (Nts), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Nts (67405)
Length:
1105
CDS:
138..530

Additional Resources:

NCBI RefSeq record:
XM_006513992.2
NBCI Gene record:
Nts (67405)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006513992.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000077437 GCATACATCCAAGATCAGCAA pLKO.1 140 CDS 100% 2.640 3.696 N Nts n/a
2 TRCN0000077433 GCTTCCCATAAACTGCTAGTT pLKO.1 928 3UTR 100% 4.950 3.960 N Nts n/a
3 TRCN0000423365 TAACCAAATGGAGCGTTATTA pLKO_005 852 3UTR 100% 15.000 10.500 N Nts n/a
4 TRCN0000077434 CCAGGAAGATATCCTTGATAA pLKO.1 383 CDS 100% 13.200 9.240 N Nts n/a
5 TRCN0000077436 GCCTTTCAACACTGGGAGATA pLKO.1 360 CDS 100% 4.950 3.465 N Nts n/a
6 TRCN0000077435 GCTAAATGTTTGCAGCCTCAT pLKO.1 191 CDS 100% 4.050 2.835 N Nts n/a
7 TRCN0000426254 ACCTGTGATTGTGATTGATTA pLKO_005 545 3UTR 100% 13.200 7.920 N Nts n/a
8 TRCN0000418443 AGCCCTGGAGGCAGATCTATT pLKO_005 110 5UTR 100% 13.200 7.920 N Nts n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006513992.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.