Transcript: Mouse XM_006514015.3

PREDICTED: Mus musculus ATPase, Ca++ transporting, plasma membrane 1 (Atp2b1), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Atp2b1 (67972)
Length:
7430
CDS:
657..4406

Additional Resources:

NCBI RefSeq record:
XM_006514015.3
NBCI Gene record:
Atp2b1 (67972)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006514015.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000101642 CCATAGTATCATTGGGCCTTT pLKO.1 1009 CDS 100% 4.050 5.670 N Atp2b1 n/a
2 TRCN0000101640 CCCTGGATCATTGAGTGAATA pLKO.1 4762 3UTR 100% 13.200 9.240 N Atp2b1 n/a
3 TRCN0000101643 CCAGCCGCTTAAAGTTTCTAA pLKO.1 3844 CDS 100% 5.625 3.938 N Atp2b1 n/a
4 TRCN0000043071 GCAGATTTAGAAAGAAGAGAA pLKO.1 882 CDS 100% 4.950 3.465 N ATP2B1 n/a
5 TRCN0000333464 GCAGATTTAGAAAGAAGAGAA pLKO_005 882 CDS 100% 4.950 3.465 N ATP2B1 n/a
6 TRCN0000101644 GCCTCCGAGATCATTCTGAAA pLKO.1 2463 CDS 100% 4.950 3.465 N Atp2b1 n/a
7 TRCN0000101641 CCCACCAAATATCCTGTCCTA pLKO.1 2174 CDS 100% 2.640 1.848 N Atp2b1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006514015.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.