Transcript: Mouse XM_006514025.2

PREDICTED: Mus musculus melanoma associated antigen (mutated) 1 (Mum1), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Mum1 (68114)
Length:
2628
CDS:
191..2239

Additional Resources:

NCBI RefSeq record:
XM_006514025.2
NBCI Gene record:
Mum1 (68114)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006514025.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000241094 TATCACGAACCACGGTCATTT pLKO_005 1313 CDS 100% 13.200 18.480 N Mum1 n/a
2 TRCN0000340192 TACCCTGTGCGCAAGTCTATC pLKO_005 1658 CDS 100% 0.000 0.000 N Mum1 n/a
3 TRCN0000217579 GGAATACTACGCTGCTGATAT pLKO.1 1633 CDS 100% 13.200 10.560 N Mum1 n/a
4 TRCN0000217914 GAATGCTGGTCTGGCTTAAAT pLKO.1 1341 CDS 100% 15.000 10.500 N Mum1 n/a
5 TRCN0000241097 GAATGCTGGTCTGGCTTAAAT pLKO_005 1341 CDS 100% 15.000 10.500 N Mum1 n/a
6 TRCN0000192752 CCAAGGGAGAAAGTGTCTTAA pLKO.1 882 CDS 100% 13.200 9.240 N Mum1 n/a
7 TRCN0000351055 AGACAAGTCTCAGGATGATTC pLKO_005 760 CDS 100% 10.800 7.560 N Mum1 n/a
8 TRCN0000340257 AGTCCTGAAAGTCATCCAATA pLKO_005 503 CDS 100% 10.800 7.560 N Mum1 n/a
9 TRCN0000241095 AGTCGCACATTGAGAACATTG pLKO_005 372 CDS 100% 10.800 7.560 N Mum1 n/a
10 TRCN0000340195 CAGCCGAGCAGAAGTACATTC pLKO_005 2139 CDS 100% 10.800 7.560 N Mum1 n/a
11 TRCN0000241096 TGTTGCCGTCGTCTGCATTAG pLKO_005 681 CDS 100% 10.800 7.560 N Mum1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006514025.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.