Transcript: Mouse XM_006514120.2

PREDICTED: Mus musculus solute carrier family 29 (nucleoside transporters), member 3 (Slc29a3), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Slc29a3 (71279)
Length:
4834
CDS:
267..1070

Additional Resources:

NCBI RefSeq record:
XM_006514120.2
NBCI Gene record:
Slc29a3 (71279)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006514120.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000295634 CGAATAAGCTGGGCATGTTAG pLKO_005 1542 3UTR 100% 10.800 15.120 N Slc29a3 n/a
2 TRCN0000079742 AGTGTTGTGATGTTGTTCTAT pLKO.1 990 CDS 100% 5.625 3.938 N Slc29a3 n/a
3 TRCN0000288302 AGTGTTGTGATGTTGTTCTAT pLKO_005 990 CDS 100% 5.625 3.938 N Slc29a3 n/a
4 TRCN0000079738 CCTCAGCTATTTAGGGAGTTT pLKO.1 1624 3UTR 100% 4.950 3.465 N Slc29a3 n/a
5 TRCN0000079741 CTGGGCATATAAACTCCGAAA pLKO.1 346 CDS 100% 4.050 2.835 N Slc29a3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006514120.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.