Transcript: Mouse XM_006514254.3

PREDICTED: Mus musculus TBC1 domain family, member 30 (Tbc1d30), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Tbc1d30 (74694)
Length:
5108
CDS:
673..2433

Additional Resources:

NCBI RefSeq record:
XM_006514254.3
NBCI Gene record:
Tbc1d30 (74694)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006514254.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000341678 GCGGCAGTACTCCCGAATTAA pLKO_005 1509 CDS 100% 15.000 21.000 N Tbc1d30 n/a
2 TRCN0000341753 GGATTCTGGTGACTAAGTAAA pLKO_005 2613 3UTR 100% 13.200 9.240 N Tbc1d30 n/a
3 TRCN0000341752 ACCGTTTCCAGCCACGATTAA pLKO_005 1188 CDS 100% 13.200 7.920 N Tbc1d30 n/a
4 TRCN0000166364 CACACACACACACACACACAA pLKO.1 4361 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006514254.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.