Transcript: Mouse XM_006514331.1

PREDICTED: Mus musculus mitotic spindle positioning (Misp), transcript variant X4, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Misp (78906)
Length:
2462
CDS:
164..2110

Additional Resources:

NCBI RefSeq record:
XM_006514331.1
NBCI Gene record:
Misp (78906)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006514331.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000090861 CACAAGAATCTCTTGGCGGAA pLKO.1 2048 CDS 100% 2.160 3.024 N Misp n/a
2 TRCN0000265731 AGTCTCTGCTGTCCCTATTTA pLKO_005 2177 3UTR 100% 15.000 10.500 N Misp n/a
3 TRCN0000255940 CAGCTAGATCCATCCATATAG pLKO_005 867 CDS 100% 13.200 9.240 N Misp n/a
4 TRCN0000265711 GATGAGGAGATAAAGTCTTAT pLKO_005 422 CDS 100% 13.200 9.240 N Misp n/a
5 TRCN0000265721 GTGACCCTGGAGAAGTCTTTC pLKO_005 836 CDS 100% 10.800 7.560 N Misp n/a
6 TRCN0000090860 GCTTGGTACTGGATGAAGATA pLKO.1 222 CDS 100% 5.625 3.938 N Misp n/a
7 TRCN0000090859 CCAGACCAGATGTAAAGAGAA pLKO.1 330 CDS 100% 4.950 3.465 N Misp n/a
8 TRCN0000090858 CTGAAATGATAATCCACCGAT pLKO.1 2295 3UTR 100% 2.640 1.848 N Misp n/a
9 TRCN0000090862 GTGTGGTGAGATTAGGGAATT pLKO.1 1551 CDS 100% 0.000 0.000 N Misp n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006514331.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.