Transcript: Mouse XM_006514450.3

PREDICTED: Mus musculus coiled coil domain containing 88A (Ccdc88a), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ccdc88a (108686)
Length:
7959
CDS:
708..6758

Additional Resources:

NCBI RefSeq record:
XM_006514450.3
NBCI Gene record:
Ccdc88a (108686)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006514450.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000178038 GCTTACCTCAATACAGTTGAA pLKO.1 5789 CDS 100% 4.950 6.930 N Ccdc88a n/a
2 TRCN0000176792 CCAAGCAGTTGGTTAATAATA pLKO.1 5359 CDS 100% 15.000 10.500 N Ccdc88a n/a
3 TRCN0000181335 CCAAGCACTCAAGGAAAGATA pLKO.1 6036 CDS 100% 5.625 3.938 N Ccdc88a n/a
4 TRCN0000177786 CCACAAGGTATTAGTGATGAT pLKO.1 5409 CDS 100% 4.950 3.465 N Ccdc88a n/a
5 TRCN0000182719 CGGGAACGTCAGAAATCTCTA pLKO.1 4941 CDS 100% 4.950 3.465 N Ccdc88a n/a
6 TRCN0000178125 GTGGAACATAAAGACCTTGAA pLKO.1 4284 CDS 100% 4.950 3.465 N Ccdc88a n/a
7 TRCN0000200269 CAGTCGATTCATCACCACCTA pLKO.1 6214 CDS 100% 2.640 1.848 N Ccdc88a n/a
8 TRCN0000166364 CACACACACACACACACACAA pLKO.1 7932 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006514450.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.