Transcript: Mouse XM_006514486.1

PREDICTED: Mus musculus dopa decarboxylase (Ddc), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ddc (13195)
Length:
2041
CDS:
66..1607

Additional Resources:

NCBI RefSeq record:
XM_006514486.1
NBCI Gene record:
Ddc (13195)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006514486.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000108479 CTGGGTTAATTGGTGGAATAA pLKO.1 757 CDS 100% 13.200 18.480 N Ddc n/a
2 TRCN0000108478 GCTCCAATGAGTTGAACGAAA pLKO.1 1408 CDS 100% 4.950 6.930 N Ddc n/a
3 TRCN0000316566 GCTCCAATGAGTTGAACGAAA pLKO_005 1408 CDS 100% 4.950 6.930 N Ddc n/a
4 TRCN0000304809 ACCACTCCGTCTTCGTGAAAT pLKO_005 1678 3UTR 100% 13.200 10.560 N Ddc n/a
5 TRCN0000304864 GCAAGGAGATGGTGGATTATA pLKO_005 193 CDS 100% 15.000 10.500 N Ddc n/a
6 TRCN0000304808 CTACTGGCTGCTCGGACTAAA pLKO_005 630 CDS 100% 13.200 9.240 N Ddc n/a
7 TRCN0000108476 CCAGAAACATACGAGGACATA pLKO.1 312 CDS 100% 4.950 3.465 N Ddc n/a
8 TRCN0000108477 CCTTTAATATGGACCCTGTTT pLKO.1 1138 CDS 100% 4.950 3.465 N Ddc n/a
9 TRCN0000316493 CCTTTAATATGGACCCTGTTT pLKO_005 1138 CDS 100% 4.950 3.465 N Ddc n/a
10 TRCN0000108475 GCCTTTAATATGGACCCTGTT pLKO.1 1137 CDS 100% 4.050 2.835 N Ddc n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006514486.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.