Transcript: Mouse XM_006514632.3

PREDICTED: Mus musculus WD repeat containing planar cell polarity effector (Wdpcp), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Wdpcp (216560)
Length:
3082
CDS:
588..2921

Additional Resources:

NCBI RefSeq record:
XM_006514632.3
NBCI Gene record:
Wdpcp (216560)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006514632.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000178827 CAGAATCACGAGATTATCCTT pLKO.1 808 CDS 100% 3.000 4.200 N Wdpcp n/a
2 TRCN0000184335 GCTGGCAGAATCACGAGATTA pLKO.1 803 CDS 100% 13.200 9.240 N Wdpcp n/a
3 TRCN0000184284 GCACCTTACACATTGCGGATA pLKO.1 697 CDS 100% 4.050 2.835 N Wdpcp n/a
4 TRCN0000196157 GCCTTCTTCCTTCCATTGGTT pLKO.1 2665 CDS 100% 3.000 2.100 N Wdpcp n/a
5 TRCN0000413041 AGGAAGAAGAGGAGGAGGAAG pLKO_005 2761 CDS 100% 4.050 2.025 Y Myt1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006514632.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.