Transcript: Mouse XM_006514695.3

PREDICTED: Mus musculus echinoderm microtubule associated protein like 6 (Eml6), transcript variant X8, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Eml6 (237711)
Length:
5228
CDS:
129..3722

Additional Resources:

NCBI RefSeq record:
XM_006514695.3
NBCI Gene record:
Eml6 (237711)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006514695.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000174438 CCTAACCAATATGTAGCGTTT pLKO.1 3999 3UTR 100% 4.050 5.670 N Eml6 n/a
2 TRCN0000216064 CAACTGACTAATCAATGATAT pLKO.1 5041 3UTR 100% 13.200 9.240 N Eml6 n/a
3 TRCN0000216325 GATGATTAATGCAGGGTAAAT pLKO.1 4517 3UTR 100% 13.200 9.240 N Eml6 n/a
4 TRCN0000193265 CAGTTGACTTCTATGACCTTA pLKO.1 3223 CDS 100% 4.950 3.465 N Eml6 n/a
5 TRCN0000174738 GAAACTGTTAAACAAGGTGAA pLKO.1 3002 CDS 100% 4.050 2.835 N Eml6 n/a
6 TRCN0000194452 GCTTATTGTGACTGGCGGAAA pLKO.1 2669 CDS 100% 4.050 2.835 N Eml6 n/a
7 TRCN0000194111 GAAGCAAGTAACTGAAGCCAT pLKO.1 3386 CDS 100% 2.640 1.848 N Eml6 n/a
8 TRCN0000042897 GCCCGAGAAACTCCAGAAGTT pLKO.1 1877 CDS 100% 4.950 2.970 N SLC6A11 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006514695.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.