Transcript: Mouse XM_006514758.2

PREDICTED: Mus musculus polymerase (DNA directed), mu (Polm), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Polm (54125)
Length:
3248
CDS:
1072..2079

Additional Resources:

NCBI RefSeq record:
XM_006514758.2
NBCI Gene record:
Polm (54125)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006514758.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000376984 TTCCGCGTCCTAGATGCTTAC pLKO_005 756 5UTR 100% 6.000 8.400 N Polm n/a
2 TRCN0000111385 CGAGACCTATAAAGTCCCTTT pLKO.1 3096 3UTR 100% 4.050 5.670 N Polm n/a
3 TRCN0000332451 CGAGACCTATAAAGTCCCTTT pLKO_005 3096 3UTR 100% 4.050 5.670 N Polm n/a
4 TRCN0000376906 AGCTGTGAGGGTAGATCTTGT pLKO_005 1833 CDS 100% 4.950 3.960 N Polm n/a
5 TRCN0000306478 GAAAGCAGGGCTCCAATATTA pLKO_005 1416 CDS 100% 15.000 10.500 N Polm n/a
6 TRCN0000306425 ACAGCCAGCTCTGCTAGATAT pLKO_005 872 5UTR 100% 13.200 9.240 N Polm n/a
7 TRCN0000111387 CCATGATGTAGACTTCCTTAT pLKO.1 1572 CDS 100% 10.800 7.560 N Polm n/a
8 TRCN0000111388 CTCACCTCTCACACACCATAA pLKO.1 1025 5UTR 100% 10.800 7.560 N Polm n/a
9 TRCN0000379299 TGGACTGGCTCCCAGTTCTTT pLKO_005 1894 CDS 100% 5.625 3.938 N Polm n/a
10 TRCN0000111386 CTGCCCTACTTTGGAGAACAT pLKO.1 1192 CDS 100% 4.950 3.465 N Polm n/a
11 TRCN0000111389 CCCAAAGTGATGAGCTGCCTA pLKO.1 1630 CDS 100% 2.640 1.848 N Polm n/a
12 TRCN0000306480 GAACATGTGAAGAAGTGAAAC pLKO_005 1247 CDS 100% 10.800 6.480 N Polm n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006514758.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.