Transcript: Mouse XM_006514763.3

PREDICTED: Mus musculus family with sequence similarity 196, member B (Fam196b), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Fam196b (574403)
Length:
6866
CDS:
2522..4129

Additional Resources:

NCBI RefSeq record:
XM_006514763.3
NBCI Gene record:
Fam196b (574403)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006514763.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000270702 CAATAGCAGTGCCAGTAATAT pLKO_005 3304 CDS 100% 15.000 21.000 N Fam196b n/a
2 TRCN0000270703 TAAGGTTGCCCATGGGTATTA pLKO_005 4736 3UTR 100% 13.200 18.480 N Fam196b n/a
3 TRCN0000272467 TTCAGGTTCCAGATGATATTT pLKO_005 3126 CDS 100% 15.000 10.500 N INSYN2B n/a
4 TRCN0000270646 AGAACACAGCATGCATCATAT pLKO_005 3918 CDS 100% 13.200 9.240 N Fam196b n/a
5 TRCN0000270645 GCTGAAGAGAGCAACTCTATA pLKO_005 3200 CDS 100% 13.200 9.240 N Fam196b n/a
6 TRCN0000270653 TCAAGGAAGATGGCAACATTA pLKO_005 2637 CDS 100% 13.200 9.240 N Fam196b n/a
7 TRCN0000166364 CACACACACACACACACACAA pLKO.1 410 5UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006514763.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.