Transcript: Mouse XM_006514913.3

PREDICTED: Mus musculus kringle containing transmembrane protein 1 (Kremen1), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Kremen1 (84035)
Length:
1159
CDS:
134..871

Additional Resources:

NCBI RefSeq record:
XM_006514913.3
NBCI Gene record:
Kremen1 (84035)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006514913.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000442375 ATCCGTACAACACGCTGAAGT pLKO_005 324 CDS 100% 4.950 6.930 N Kremen1 n/a
2 TRCN0000072030 GAGCACAATTATTGCAGAAAT pLKO.1 371 CDS 100% 13.200 9.240 N Kremen1 n/a
3 TRCN0000072029 GCTCACCATACAAACCTGTAT pLKO.1 556 CDS 100% 0.495 0.347 N Kremen1 n/a
4 TRCN0000176490 CCTGGGTTCTATAAGAAAGTA pLKO.1 1137 3UTR 100% 5.625 2.813 Y Il1bos n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006514913.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.