Transcript: Mouse XM_006514978.3

PREDICTED: Mus musculus lipin 1 (Lpin1), transcript variant X4, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Lpin1 (14245)
Length:
4028
CDS:
20..2953

Additional Resources:

NCBI RefSeq record:
XM_006514978.3
NBCI Gene record:
Lpin1 (14245)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006514978.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000098297 GCCGTGTCATATCAGCAATTT pLKO.1 1661 CDS 100% 13.200 18.480 N Lpin1 n/a
2 TRCN0000098299 GCCCAGTTGGACAATCTCAAA pLKO.1 683 CDS 100% 4.950 6.930 N Lpin1 n/a
3 TRCN0000305830 CTTGACGCGACCGAGCATTAA pLKO_005 2949 CDS 100% 13.200 9.240 N Lpin1 n/a
4 TRCN0000305768 AGTAAGGCCCAGACGGAAATG pLKO_005 1202 CDS 100% 10.800 7.560 N Lpin1 n/a
5 TRCN0000098298 CCAGTGTTTGACAGACATCAA pLKO.1 2611 CDS 100% 4.950 3.465 N Lpin1 n/a
6 TRCN0000324696 CCAGTGTTTGACAGACATCAA pLKO_005 2611 CDS 100% 4.950 3.465 N Lpin1 n/a
7 TRCN0000098296 CGCCAAAGAATAACCTGGAAA pLKO.1 993 CDS 100% 4.950 3.465 N Lpin1 n/a
8 TRCN0000305829 TGTGGAATTGGGACGACAAAG pLKO_005 2280 CDS 100% 10.800 6.480 N Lpin1 n/a
9 TRCN0000098295 GCTCTTTAATTGCTTTGGTTA pLKO.1 3525 3UTR 100% 4.950 2.970 N Lpin1 n/a
10 TRCN0000324634 GCTCTTTAATTGCTTTGGTTA pLKO_005 3525 3UTR 100% 4.950 2.970 N Lpin1 n/a
11 TRCN0000150763 GCAGAACTCTTCCTAATGATA pLKO.1 792 CDS 100% 5.625 3.938 N LPIN1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006514978.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.