Transcript: Mouse XM_006514990.3

PREDICTED: Mus musculus integrin beta 1 binding protein 1 (Itgb1bp1), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Itgb1bp1 (16413)
Length:
1306
CDS:
447..1109

Additional Resources:

NCBI RefSeq record:
XM_006514990.3
NBCI Gene record:
Itgb1bp1 (16413)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006514990.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000285680 ATGTGCTGAGTTCCGAATAAA pLKO_005 623 CDS 100% 15.000 12.000 N Itgb1bp1 n/a
2 TRCN0000217208 CATGTGCTGAGTTCCGAATAA pLKO.1 622 CDS 100% 13.200 9.240 N Itgb1bp1 n/a
3 TRCN0000285681 ATGTTGGTGCCATCGAGAAAC pLKO_005 646 CDS 100% 10.800 7.560 N Itgb1bp1 n/a
4 TRCN0000178607 CCTTTGGAAGAGGAGTTCATT pLKO.1 759 CDS 100% 5.625 3.938 N Itgb1bp1 n/a
5 TRCN0000276782 CCTTTGGAAGAGGAGTTCATT pLKO_005 759 CDS 100% 5.625 3.938 N Itgb1bp1 n/a
6 TRCN0000181435 CCTCGATACAGACTCCACTAA pLKO.1 569 CDS 100% 4.950 3.465 N Itgb1bp1 n/a
7 TRCN0000276781 CCTCGATACAGACTCCACTAA pLKO_005 569 CDS 100% 4.950 3.465 N Itgb1bp1 n/a
8 TRCN0000122922 GCAAGATGGAAAGTTGCCTTT pLKO.1 734 CDS 100% 4.050 2.835 N ITGB1BP1 n/a
9 TRCN0000319089 GCAAGATGGAAAGTTGCCTTT pLKO_005 734 CDS 100% 4.050 2.835 N ITGB1BP1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006514990.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.