Transcript: Mouse XM_006515200.2

PREDICTED: Mus musculus lipid droplet associated hydrolase (Ldah), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ldah (68832)
Length:
2756
CDS:
108..1088

Additional Resources:

NCBI RefSeq record:
XM_006515200.2
NBCI Gene record:
Ldah (68832)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006515200.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000328584 TATGGTCTGAATGGTCAAATA pLKO_005 438 CDS 100% 13.200 18.480 N Ldah n/a
2 TRCN0000200248 CCCGGTATGGATAATCTCTCA pLKO.1 332 CDS 100% 2.640 3.696 N Ldah n/a
3 TRCN0000328582 CCCGGTATGGATAATCTCTCA pLKO_005 332 CDS 100% 2.640 3.696 N Ldah n/a
4 TRCN0000328524 GCGAGATGATGACATCATAAA pLKO_005 860 CDS 100% 13.200 10.560 N Ldah n/a
5 TRCN0000182427 GCAGTGAGCAAAGGATGCTAA pLKO.1 1471 3UTR 100% 4.950 3.465 N Ldah n/a
6 TRCN0000353524 GCAGTGAGCAAAGGATGCTAA pLKO_005 1471 3UTR 100% 4.950 3.465 N Ldah n/a
7 TRCN0000182700 GCTCTATGCTACCAGCTACTT pLKO.1 677 CDS 100% 4.950 3.465 N Ldah n/a
8 TRCN0000200208 CCTTGCTTATAGAGCAGGCTT pLKO.1 2528 3UTR 100% 2.640 1.848 N Ldah n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006515200.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.