Transcript: Mouse XM_006515246.3

PREDICTED: Mus musculus family with sequence similarity 49, member A (Fam49a), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Fam49a (76820)
Length:
4929
CDS:
405..1376

Additional Resources:

NCBI RefSeq record:
XM_006515246.3
NBCI Gene record:
Fam49a (76820)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006515246.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000438204 GTACGATGACAAGCGTCTGTA pLKO_005 1075 CDS 100% 4.950 6.930 N Fam49a n/a
2 TRCN0000183600 GCCTGTTTGATTACTTGTAAA pLKO.1 3022 3UTR 100% 13.200 9.240 N Fam49a n/a
3 TRCN0000419120 ACCGATGTTGAAGACTCTTAG pLKO_005 986 CDS 100% 10.800 7.560 N Fam49a n/a
4 TRCN0000184729 CCAGAGATCCGAGATGCAATT pLKO.1 582 CDS 100% 10.800 7.560 N Fam49a n/a
5 TRCN0000183380 GAATGATGAATCGACTTCCAA pLKO.1 1331 CDS 100% 3.000 2.100 N Fam49a n/a
6 TRCN0000183051 CGCAAAGGAATTTGCAGAAAT pLKO.1 785 CDS 100% 1.320 0.924 N Fam49a n/a
7 TRCN0000135692 CAATCGAATGTCCCTCTTCTA pLKO.1 953 CDS 100% 4.950 2.970 N FAM49A n/a
8 TRCN0000135569 GCTGACCTCAGAAGATGTATA pLKO.1 1403 3UTR 100% 13.200 9.240 N FAM49A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006515246.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.