Transcript: Mouse XM_006515319.3

PREDICTED: Mus musculus RIKEN cDNA 1700047I17 gene 2 (1700047I17Rik2), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
1700047I17Rik2 (100101807)
Length:
1287
CDS:
214..672

Additional Resources:

NCBI RefSeq record:
XM_006515319.3
NBCI Gene record:
1700047I17Rik2 (100101807)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006515319.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000437422 CCTTTGCACCAGGTGAGTTTA pLKO_005 1014 3UTR 100% 13.200 6.600 Y Fam177a n/a
2 TRCN0000430978 GAAGACTGTGAAGCAATTAAG pLKO_005 616 CDS 100% 13.200 6.600 Y Fam177a n/a
3 TRCN0000182583 GCGACACGGCAGATAAGTAAT pLKO.1 283 CDS 100% 13.200 6.600 Y Fam177a n/a
4 TRCN0000432395 TCTACATTAAGAGCGTGAAAT pLKO_005 1118 3UTR 100% 13.200 6.600 Y Fam177a n/a
5 TRCN0000435187 GAGGAGGGTCATCCACTTTGT pLKO_005 360 CDS 100% 4.950 2.475 Y Fam177a n/a
6 TRCN0000177204 GCAGAAAGACAATACCAACAA pLKO.1 508 CDS 100% 4.950 2.475 Y Fam177a n/a
7 TRCN0000439184 AGAGACAATGGAGGAGTACAG pLKO_005 387 CDS 100% 4.050 2.025 Y Fam177a n/a
8 TRCN0000418270 ATGTAGAACTGGGCGTCATGG pLKO_005 320 CDS 100% 4.050 2.025 Y Fam177a n/a
9 TRCN0000178297 GCATGGTACTACATGCCTTTA pLKO.1 992 3UTR 100% 1.080 0.540 Y Fam177a n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006515319.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.