Transcript: Mouse XM_006515325.1

PREDICTED: Mus musculus tetratricopeptide repeat domain 7B (Ttc7b), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ttc7b (104718)
Length:
3722
CDS:
130..2943

Additional Resources:

NCBI RefSeq record:
XM_006515325.1
NBCI Gene record:
Ttc7b (104718)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006515325.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000341694 AGGGTAATGCTAACTAATATT pLKO_005 703 CDS 100% 15.000 10.500 N Ttc7b n/a
2 TRCN0000341695 TTACGTGGAAGGAGATTATAA pLKO_005 450 CDS 100% 15.000 10.500 N Ttc7b n/a
3 TRCN0000341764 ATGTAACCAGAGTGGATTAAC pLKO_005 3052 3UTR 100% 13.200 9.240 N Ttc7b n/a
4 TRCN0000341693 GTTTCGTCCTCTACCAGTAAT pLKO_005 598 CDS 100% 13.200 9.240 N Ttc7b n/a
5 TRCN0000341767 TCTTCCCAATGTCCCATAATG pLKO_005 2585 CDS 100% 13.200 9.240 N Ttc7b n/a
6 TRCN0000146681 CCTACAAGAATCCAATCTGAT pLKO.1 414 CDS 100% 4.950 3.465 N TTC7B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006515325.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.