Transcript: Mouse XM_006515529.1

PREDICTED: Mus musculus ninein (Nin), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Nin (18080)
Length:
9926
CDS:
246..6614

Additional Resources:

NCBI RefSeq record:
XM_006515529.1
NBCI Gene record:
Nin (18080)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006515529.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000114701 CGGCACTTGTTAGAACGAGTT pLKO.1 1353 CDS 100% 4.050 5.670 N Nin n/a
2 TRCN0000114702 CGAGGATTAGAAACAATCCAT pLKO.1 6015 CDS 100% 0.300 0.240 N Nin n/a
3 TRCN0000114705 GCGCAGATGAGAAATGAATAT pLKO.1 1845 CDS 100% 13.200 9.240 N Nin n/a
4 TRCN0000413040 ATCTGCGAACAGTATGGATTA pLKO_005 873 CDS 100% 10.800 7.560 N Nin n/a
5 TRCN0000114703 GCACAGAATTGCTACAATGAA pLKO.1 5423 CDS 100% 5.625 3.938 N Nin n/a
6 TRCN0000114704 GCATCTCTCTATGCAGTCTTT pLKO.1 1043 CDS 100% 4.950 3.465 N Nin n/a
7 TRCN0000441660 GTTAGAGGTGGGAAGCGTTAT pLKO_005 540 CDS 100% 10.800 6.480 N Nin n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006515529.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.