Transcript: Mouse XM_006515743.2

PREDICTED: Mus musculus unc-79 homolog (C. elegans) (Unc79), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Unc79 (217843)
Length:
10274
CDS:
1455..9659

Additional Resources:

NCBI RefSeq record:
XM_006515743.2
NBCI Gene record:
Unc79 (217843)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006515743.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000268986 CTTAGCAATAATGGGTATAAA pLKO_005 9693 3UTR 100% 15.000 21.000 N Unc79 n/a
2 TRCN0000268987 GTCCTCAACTCCGGCATTATT pLKO_005 5716 CDS 100% 15.000 21.000 N Unc79 n/a
3 TRCN0000268935 TGGGATCCCTCACGCATAATG pLKO_005 9010 CDS 100% 13.200 18.480 N Unc79 n/a
4 TRCN0000281691 CAACCGTGATGGCCGACAAAT pLKO_005 7753 CDS 100% 13.200 9.240 N Unc79 n/a
5 TRCN0000283861 GTGTATCATTGTCAATTATTG pLKO_005 2247 CDS 100% 13.200 9.240 N Unc79 n/a
6 TRCN0000183484 GAAGCTTTCTTGCTACACATA pLKO.1 9813 3UTR 100% 4.950 3.465 N UNC79 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006515743.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.