Transcript: Mouse XM_006515878.2

PREDICTED: Mus musculus pleckstrin homology domain containing, family G (with RhoGef domain) member 3 (Plekhg3), transcript variant X10, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Plekhg3 (263406)
Length:
4779
CDS:
61..3741

Additional Resources:

NCBI RefSeq record:
XM_006515878.2
NBCI Gene record:
Plekhg3 (263406)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006515878.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000419051 ACAACCAGCGAGTGATCATTA pLKO_005 3904 3UTR 100% 13.200 18.480 N Plekhg3 n/a
2 TRCN0000425540 AGCCTCTCCTATATCCCTAAA pLKO_005 2707 CDS 100% 10.800 7.560 N Plekhg3 n/a
3 TRCN0000437689 AGGTCCAGATGAGCTACTTAC pLKO_005 4356 3UTR 100% 10.800 7.560 N Plekhg3 n/a
4 TRCN0000217056 CCTTTAACTGCCTTGTCATAG pLKO.1 4526 3UTR 100% 10.800 7.560 N Plekhg3 n/a
5 TRCN0000183787 CACTCAGTATTGCAACAACTA pLKO.1 663 CDS 100% 4.950 3.465 N Plekhg3 n/a
6 TRCN0000179636 GCAAGACAAGCAACAAGCTAA pLKO.1 717 CDS 100% 4.950 3.465 N Plekhg3 n/a
7 TRCN0000179378 GCGCAATGACAGAACTTTCTT pLKO.1 1065 CDS 100% 5.625 3.375 N Plekhg3 n/a
8 TRCN0000048681 GAAGCCATCTTGGAAATGGAT pLKO.1 1342 CDS 100% 3.000 2.100 N PLEKHG3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006515878.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.