Transcript: Mouse XM_006515925.2

PREDICTED: Mus musculus protein phosphatase 2, regulatory subunit B', epsilon (Ppp2r5e), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ppp2r5e (26932)
Length:
6274
CDS:
620..2023

Additional Resources:

NCBI RefSeq record:
XM_006515925.2
NBCI Gene record:
Ppp2r5e (26932)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006515925.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000433825 CTTAGACGCGATGGGATAATT pLKO_005 1994 CDS 100% 15.000 21.000 N Ppp2r5e n/a
2 TRCN0000080772 GACACGCTATCTGATCTTAAA pLKO.1 851 CDS 100% 13.200 18.480 N Ppp2r5e n/a
3 TRCN0000414793 GACATGACTGTAACGTGATAT pLKO_005 2488 3UTR 100% 13.200 18.480 N Ppp2r5e n/a
4 TRCN0000080769 CCAGCCTTTATAGGATTTCAA pLKO.1 1785 CDS 100% 5.625 7.875 N Ppp2r5e n/a
5 TRCN0000080771 GCTTAGAGCATTTATCCGAAA pLKO.1 1255 CDS 100% 4.050 3.240 N Ppp2r5e n/a
6 TRCN0000002559 CCTCCTAGTGACAGCAATGAA pLKO.1 1001 CDS 100% 5.625 3.938 N PPP2R5E n/a
7 TRCN0000272792 CCTCCTAGTGACAGCAATGAA pLKO_005 1001 CDS 100% 5.625 3.938 N PPP2R5E n/a
8 TRCN0000080770 CCTGAACTGTTCCTAAAGAAA pLKO.1 797 CDS 100% 5.625 3.938 N Ppp2r5e n/a
9 TRCN0000080768 CCTGTCTCTAAGTAAAGGAAA pLKO.1 2160 3UTR 100% 4.950 3.465 N Ppp2r5e n/a
10 TRCN0000002557 CCTGAAGTAGTTAGAATGGTA pLKO.1 956 CDS 100% 3.000 2.100 N PPP2R5E n/a
11 TRCN0000272793 CCTGAAGTAGTTAGAATGGTA pLKO_005 956 CDS 100% 3.000 2.100 N PPP2R5E n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006515925.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.