Transcript: Mouse XM_006515942.2

PREDICTED: Mus musculus neuronal PAS domain protein 3 (Npas3), transcript variant X5, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Npas3 (27386)
Length:
6520
CDS:
587..3421

Additional Resources:

NCBI RefSeq record:
XM_006515942.2
NBCI Gene record:
Npas3 (27386)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006515942.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000432809 ATCCGACTTACAATTAGTTAT pLKO_005 884 CDS 100% 13.200 18.480 N Npas3 n/a
2 TRCN0000417709 ATTGCGCAACTCCCGCATTTG pLKO_005 1988 CDS 100% 10.800 15.120 N Npas3 n/a
3 TRCN0000377339 TAAAGACACCTCAGGTATTAC pLKO_005 2059 CDS 100% 13.200 9.240 N NPAS3 n/a
4 TRCN0000096456 GCAGAAGAATGGAGGCTACAT pLKO.1 1852 CDS 100% 4.950 3.465 N Npas3 n/a
5 TRCN0000096454 CCTGTAGACATCGTAGGGAAA pLKO.1 1727 CDS 100% 4.050 2.835 N Npas3 n/a
6 TRCN0000096455 CCCTGTAGACATCGTAGGGAA pLKO.1 1726 CDS 100% 2.640 1.848 N Npas3 n/a
7 TRCN0000020977 GCTGTTAACTTCGTGGACGTT pLKO.1 3167 CDS 100% 2.640 1.848 N NPAS3 n/a
8 TRCN0000364654 TCGACAAGGCATCCATCATTC pLKO_005 867 CDS 100% 10.800 7.560 N NPAS3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006515942.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.