Transcript: Mouse XM_006516013.2

PREDICTED: Mus musculus MAM domain containing glycosylphosphatidylinositol anchor 2 (Mdga2), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Mdga2 (320772)
Length:
15189
CDS:
910..3093

Additional Resources:

NCBI RefSeq record:
XM_006516013.2
NBCI Gene record:
Mdga2 (320772)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006516013.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000030459 CCCTCAAGATTATGCTAACTA pLKO.1 843 5UTR 100% 5.625 7.875 N Mdga2 n/a
2 TRCN0000030461 CCGGAACAACAAACTTGGATA pLKO.1 1412 CDS 100% 4.950 3.960 N Mdga2 n/a
3 TRCN0000030463 CGATGGAATGAAGCTCATGTT pLKO.1 2851 CDS 100% 4.950 3.960 N Mdga2 n/a
4 TRCN0000030460 CGGATAACTTTGACTGGACAA pLKO.1 2510 CDS 100% 4.050 2.835 N Mdga2 n/a
5 TRCN0000030462 CCCACTAAAGAGTCTTTCCAA pLKO.1 2010 CDS 100% 3.000 2.100 N Mdga2 n/a
6 TRCN0000006965 GCAGCTTTCTTGTTACAGGAA pLKO.1 2087 CDS 100% 2.640 1.848 N MDGA2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006516013.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.