Transcript: Mouse XM_006516305.3

PREDICTED: Mus musculus tandem C2 domains, nuclear (Tc2n), transcript variant X6, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Tc2n (74413)
Length:
4724
CDS:
114..1193

Additional Resources:

NCBI RefSeq record:
XM_006516305.3
NBCI Gene record:
Tc2n (74413)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006516305.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000126913 TGGAAATAATAGCACCTTCAA pLKO.1 739 CDS 100% 4.950 6.930 N Tc2n n/a
2 TRCN0000126911 GCCTGGATACAATTACCCTAT pLKO.1 352 CDS 100% 4.050 3.240 N Tc2n n/a
3 TRCN0000422827 ATGGATCTGTTTGTGATTTAA pLKO_005 181 CDS 100% 15.000 10.500 N Tc2n n/a
4 TRCN0000427254 GATAAGTGAAGACAGTAATAA pLKO_005 1088 CDS 100% 15.000 10.500 N Tc2n n/a
5 TRCN0000422755 AGTAGCATTTGGCCAACTTAA pLKO_005 1336 3UTR 100% 13.200 9.240 N Tc2n n/a
6 TRCN0000126909 GCTGAAGAGACAGCTTGACAT pLKO.1 1213 3UTR 100% 4.950 3.465 N Tc2n n/a
7 TRCN0000126910 CCTGATTTAAGTAGGCGCTTT pLKO.1 132 CDS 100% 4.050 2.835 N Tc2n n/a
8 TRCN0000059542 GCATTTCAAATCTTCAGCCAA pLKO.1 542 CDS 100% 2.640 1.848 N TC2N n/a
9 TRCN0000166364 CACACACACACACACACACAA pLKO.1 1844 3UTR 100% 4.950 2.475 Y KAAG1 n/a
10 TRCN0000162548 CACACACACACACACAAATAT pLKO.1 1848 3UTR 100% 15.000 7.500 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006516305.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.