Transcript: Mouse XM_006516377.3

PREDICTED: Mus musculus leucine rich repeat containing 9 (Lrrc9), transcript variant X7, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Lrrc9 (78257)
Length:
8335
CDS:
285..4625

Additional Resources:

NCBI RefSeq record:
XM_006516377.3
NBCI Gene record:
Lrrc9 (78257)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006516377.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000088024 GCCCATCAATAAAGCCAACTA pLKO.1 1967 CDS 100% 4.950 3.960 N Lrrc9 n/a
2 TRCN0000088027 CCAGAGTACATCGTTGAATTT pLKO.1 2100 CDS 100% 13.200 9.240 N Lrrc9 n/a
3 TRCN0000088025 GCTCAAGATATAAGGGAAATT pLKO.1 471 CDS 100% 13.200 9.240 N Lrrc9 n/a
4 TRCN0000088023 CCCATCAATAAAGCCAACTAT pLKO.1 1968 CDS 100% 5.625 3.938 N Lrrc9 n/a
5 TRCN0000088026 GCGGGTCATTAAAGTCAACAA pLKO.1 1565 CDS 100% 4.950 3.465 N Lrrc9 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006516377.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.