Transcript: Mouse XM_006516463.2

PREDICTED: Mus musculus family with sequence similarity 208, member B (Fam208b), transcript variant X4, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Fam208b (105203)
Length:
7398
CDS:
287..6769

Additional Resources:

NCBI RefSeq record:
XM_006516463.2
NBCI Gene record:
Fam208b (105203)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006516463.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000175104 GCATTAGCTTTGGGTTATAAT pLKO.1 6894 3UTR 100% 15.000 21.000 N Fam208b n/a
2 TRCN0000279310 GCATTAGCTTTGGGTTATAAT pLKO_005 6894 3UTR 100% 15.000 21.000 N Fam208b n/a
3 TRCN0000217734 GACGTCAGGGTAGATTCAATT pLKO.1 6461 CDS 100% 13.200 18.480 N Fam208b n/a
4 TRCN0000216460 GTATGCATAAATAGGTCTTTA pLKO.1 2069 CDS 100% 13.200 18.480 N Fam208b n/a
5 TRCN0000279313 TGCCAAATATGGAGGTAATTT pLKO_005 4114 CDS 100% 15.000 12.000 N Fam208b n/a
6 TRCN0000216646 CAGAATGGCCAGCTTACTTAA pLKO.1 4582 CDS 100% 13.200 10.560 N Fam208b n/a
7 TRCN0000217276 CCAAGACTTACGCTAACTTTA pLKO.1 5262 CDS 100% 13.200 10.560 N Fam208b n/a
8 TRCN0000278654 TAGTGGCAGTAGTAGTCTAAA pLKO_005 3316 CDS 100% 13.200 10.560 N Fam208b n/a
9 TRCN0000174964 GTGAGCATAGTGAGAATTTAT pLKO.1 4041 CDS 100% 15.000 10.500 N Fam208b n/a
10 TRCN0000279309 GTGAGCATAGTGAGAATTTAT pLKO_005 4041 CDS 100% 15.000 10.500 N Fam208b n/a
11 TRCN0000216194 CATTTCACATTTGCATCAAAT pLKO.1 6190 CDS 100% 13.200 9.240 N Fam208b n/a
12 TRCN0000217490 GGAATCCAGAGAACTACTAAA pLKO.1 3646 CDS 100% 13.200 9.240 N Fam208b n/a
13 TRCN0000279373 TTCACCCATCACCGCTGATAA pLKO_005 2625 CDS 100% 13.200 9.240 N Fam208b n/a
14 TRCN0000174274 CCTTGTTACAGATGTAAACTA pLKO.1 6694 CDS 100% 5.625 3.938 N Fam208b n/a
15 TRCN0000193085 CGTAAGAAACACTACATAGAT pLKO.1 7137 3UTR 100% 5.625 3.938 N Fam208b n/a
16 TRCN0000216562 GAATATCATAAGGGAGTTAAA pLKO.1 1352 CDS 100% 13.200 7.920 N Fam208b n/a
17 TRCN0000173862 GCCACGTCTTATCTCACCAAA pLKO.1 5194 CDS 100% 4.950 2.970 N Fam208b n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006516463.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.