Transcript: Mouse XM_006516532.3

PREDICTED: Mus musculus desmoplakin (Dsp), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Dsp (109620)
Length:
8007
CDS:
508..7362

Additional Resources:

NCBI RefSeq record:
XM_006516532.3
NBCI Gene record:
Dsp (109620)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006516532.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000091610 CGAGATACATTGAACTGCTTA pLKO.1 3545 CDS 100% 4.950 6.930 N Dsp n/a
2 TRCN0000091612 CCGGAACTGAAATTCGGAGAA pLKO.1 814 CDS 100% 4.050 5.670 N Dsp n/a
3 TRCN0000091609 CGAGAGATCATGTGGATCAAT pLKO.1 1384 CDS 100% 5.625 3.938 N Dsp n/a
4 TRCN0000091608 GCCTACAAGAAAGGTCTCATT pLKO.1 6190 CDS 100% 4.950 3.465 N Dsp n/a
5 TRCN0000091611 GCTGAGAGAAAGGTGCAGAAT pLKO.1 5301 CDS 100% 4.950 3.465 N Dsp n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006516532.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.