Transcript: Mouse XM_006516556.3

PREDICTED: Mus musculus hemochromatosis (Hfe), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Hfe (15216)
Length:
2667
CDS:
46..1011

Additional Resources:

NCBI RefSeq record:
XM_006516556.3
NBCI Gene record:
Hfe (15216)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006516556.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000105415 GCTTTCTCTGTTCACTTTCTT pLKO.1 1136 3UTR 100% 5.625 3.938 N Hfe n/a
2 TRCN0000105416 CGGCTTCTGGAGATATGGTTA pLKO.1 366 CDS 100% 4.950 3.465 N Hfe n/a
3 TRCN0000105418 GAACATCACTATGAGGTGGTT pLKO.1 666 CDS 100% 2.640 1.848 N Hfe n/a
4 TRCN0000105417 CTGTTCCTAATCTTAAGGAAA pLKO.1 937 CDS 100% 0.495 0.347 N Hfe n/a
5 TRCN0000105419 CAGCTCTTTGTGTCCTACAAT pLKO.1 109 CDS 100% 5.625 3.375 N Hfe n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006516556.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.