Transcript: Mouse XM_006516561.1

PREDICTED: Mus musculus lysosomal trafficking regulator (Lyst), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Lyst (17101)
Length:
13394
CDS:
251..11770

Additional Resources:

NCBI RefSeq record:
XM_006516561.1
NBCI Gene record:
Lyst (17101)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006516561.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000093510 CGGGTTATACTGTCTTTAATT pLKO.1 5735 CDS 100% 15.000 21.000 N Lyst n/a
2 TRCN0000380764 GAAGATTGCTAGCGCATATTT pLKO_005 8598 CDS 100% 15.000 21.000 N Lyst n/a
3 TRCN0000380274 GCATTAGCACTGCGGGTTATA pLKO_005 5723 CDS 100% 13.200 18.480 N Lyst n/a
4 TRCN0000093511 CGGGCTTTAGAAACCATGATA pLKO.1 10556 CDS 100% 5.625 7.875 N Lyst n/a
5 TRCN0000093512 CCCGAGAAGTTTGTAGATCAT pLKO.1 6183 CDS 100% 4.950 6.930 N Lyst n/a
6 TRCN0000093509 GCAGATATCCAGGAAAGACAA pLKO.1 11848 3UTR 100% 4.950 3.465 N Lyst n/a
7 TRCN0000093513 GCCCATCATAAGCCTGACATT pLKO.1 11620 CDS 100% 4.950 3.465 N Lyst n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006516561.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.