Transcript: Mouse XM_006516609.3

PREDICTED: Mus musculus receptor (TNFRSF)-interacting serine-threonine kinase 1 (Ripk1), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ripk1 (19766)
Length:
2616
CDS:
255..2225

Additional Resources:

NCBI RefSeq record:
XM_006516609.3
NBCI Gene record:
Ripk1 (19766)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006516609.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000022466 CGTGACTTTCACATTAAGATA pLKO.1 696 CDS 100% 5.625 7.875 N Ripk1 n/a
2 TRCN0000278131 CGTGACTTTCACATTAAGATA pLKO_005 696 CDS 100% 5.625 7.875 N Ripk1 n/a
3 TRCN0000022467 GCCAAATCTAAGCCAAATGTA pLKO.1 1694 CDS 100% 5.625 4.500 N Ripk1 n/a
4 TRCN0000278195 GCCAAATCTAAGCCAAATGTA pLKO_005 1694 CDS 100% 5.625 4.500 N Ripk1 n/a
5 TRCN0000022468 GCATTGTCCTTTGGGCAATAT pLKO.1 901 CDS 100% 13.200 9.240 N Ripk1 n/a
6 TRCN0000278133 GCATTGTCCTTTGGGCAATAT pLKO_005 901 CDS 100% 13.200 9.240 N Ripk1 n/a
7 TRCN0000000709 CTTACAACAGAGAGGAGGAAA pLKO.1 1462 CDS 100% 4.950 3.465 N RIPK1 n/a
8 TRCN0000022464 CCATCTTTGATAACACCACTA pLKO.1 1930 CDS 100% 4.050 2.835 N Ripk1 n/a
9 TRCN0000297401 CCATCTTTGATAACACCACTA pLKO_005 1930 CDS 100% 4.050 2.835 N Ripk1 n/a
10 TRCN0000022465 CCTGAATGACATCAATGCAAA pLKO.1 848 CDS 100% 4.950 2.970 N Ripk1 n/a
11 TRCN0000278132 CCTGAATGACATCAATGCAAA pLKO_005 848 CDS 100% 4.950 2.970 N Ripk1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006516609.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.