Transcript: Mouse XM_006516628.3

PREDICTED: Mus musculus serine (or cysteine) peptidase inhibitor, clade B, member 9 (Serpinb9), transcript variant X4, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Serpinb9 (20723)
Length:
4002
CDS:
1846..2970

Additional Resources:

NCBI RefSeq record:
XM_006516628.3
NBCI Gene record:
Serpinb9 (20723)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006516628.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000080490 GACACATATAACCTCGCCTAT pLKO.1 2449 CDS 100% 4.050 5.670 N Serpinb9 n/a
2 TRCN0000334177 GACACATATAACCTCGCCTAT pLKO_005 2449 CDS 100% 4.050 5.670 N Serpinb9 n/a
3 TRCN0000080489 GCCTCTGCCATCATAGAATTT pLKO.1 2839 CDS 100% 13.200 9.240 N Serpinb9 n/a
4 TRCN0000080491 AGAGCACTGATGTTGAGGTTT pLKO.1 2627 CDS 100% 4.950 3.465 N Serpinb9 n/a
5 TRCN0000334178 AGAGCACTGATGTTGAGGTTT pLKO_005 2627 CDS 100% 4.950 3.465 N Serpinb9 n/a
6 TRCN0000080488 CCAGTAATTTATAGCCAGTTA pLKO.1 3210 3UTR 100% 4.950 3.465 N Serpinb9 n/a
7 TRCN0000334244 CCAGTAATTTATAGCCAGTTA pLKO_005 3210 3UTR 100% 4.950 3.465 N Serpinb9 n/a
8 TRCN0000080492 GTACTCTCTTAGAGTGGCCAA pLKO.1 2094 CDS 100% 2.160 1.512 N Serpinb9 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006516628.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.