Transcript: Mouse XM_006516736.3

PREDICTED: Mus musculus biphenyl hydrolase-like (serine hydrolase, breast epithelial mucin-associated antigen) (Bphl), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Bphl (68021)
Length:
1133
CDS:
55..822

Additional Resources:

NCBI RefSeq record:
XM_006516736.3
NBCI Gene record:
Bphl (68021)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006516736.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000221429 GCTGCAAAGTACCCATCTTAT pLKO.1 523 CDS 100% 13.200 18.480 N Bphl n/a
2 TRCN0000350103 GGGTAGCGGAAAGACCGATTT pLKO_005 288 CDS 100% 10.800 15.120 N Bphl n/a
3 TRCN0000221431 GCACAACTTACACTTACGCTT pLKO.1 759 CDS 100% 2.640 3.696 N Bphl n/a
4 TRCN0000317991 GCACAACTTACACTTACGCTT pLKO_005 759 CDS 100% 2.640 3.696 N Bphl n/a
5 TRCN0000221428 CCCATCTTATATCCGCAAGAT pLKO.1 534 CDS 100% 0.495 0.693 N Bphl n/a
6 TRCN0000314191 TCAGCTTCAGAGCCTAAATAA pLKO_005 315 CDS 100% 15.000 10.500 N Bphl n/a
7 TRCN0000314190 GATCATGTCATTGCCTGTTAC pLKO_005 870 3UTR 100% 10.800 7.560 N Bphl n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006516736.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.