Transcript: Mouse XM_006516753.3

PREDICTED: Mus musculus ras responsive element binding protein 1 (Rreb1), transcript variant X4, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Rreb1 (68750)
Length:
9301
CDS:
1147..6411

Additional Resources:

NCBI RefSeq record:
XM_006516753.3
NBCI Gene record:
Rreb1 (68750)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006516753.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000376249 ACTACCCATTCACGGTCAAAG pLKO_005 3254 CDS 100% 10.800 15.120 N Rreb1 n/a
2 TRCN0000367161 TGAGCGAACCTTCACCTTAAA pLKO_005 5967 CDS 100% 13.200 10.560 N Rreb1 n/a
3 TRCN0000377197 TGCAACATCTGTGACTATATT pLKO_005 3157 CDS 100% 15.000 10.500 N Rreb1 n/a
4 TRCN0000367160 GGACAAGATGAGCGATGAAAT pLKO_005 1740 CDS 100% 13.200 9.240 N Rreb1 n/a
5 TRCN0000218446 AGGAGTTTGTTTGCAAGTATG pLKO_005 1784 CDS 100% 10.800 7.560 N RREB1 n/a
6 TRCN0000096612 CCTGAGAAGAAACGGGCTTAT pLKO.1 5070 CDS 100% 10.800 7.560 N Rreb1 n/a
7 TRCN0000376250 GATCAGTCTTCCGCCACTTTC pLKO_005 2589 CDS 100% 10.800 7.560 N Rreb1 n/a
8 TRCN0000096611 GCTTCCATGATTTAGGGTTTA pLKO.1 1979 CDS 100% 10.800 7.560 N Rreb1 n/a
9 TRCN0000096610 CCAGTGTGTTTCAAGGAGTTT pLKO.1 1771 CDS 100% 4.950 3.465 N Rreb1 n/a
10 TRCN0000096613 CCCACTCAGATAACCCACTAA pLKO.1 1826 CDS 100% 4.950 3.465 N Rreb1 n/a
11 TRCN0000096609 CCCATGATCTTCTAAGTCAAA pLKO.1 8249 3UTR 100% 4.950 3.465 N Rreb1 n/a
12 TRCN0000022200 CCAGGAAACGAAAGAGGAGAA pLKO.1 1314 CDS 100% 4.050 2.430 N RREB1 n/a
13 TRCN0000376248 TTCAGTGCCTTAACTACTTAT pLKO_005 6614 3UTR 100% 13.200 6.600 Y Rreb1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006516753.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.