Transcript: Mouse XM_006516929.3

PREDICTED: Mus musculus FYVE, RhoGEF and PH domain containing 3 (Fgd3), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Fgd3 (30938)
Length:
3772
CDS:
914..3115

Additional Resources:

NCBI RefSeq record:
XM_006516929.3
NBCI Gene record:
Fgd3 (30938)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006516929.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000109983 CAGGTACAAGATATTGTGAAA pLKO.1 2174 CDS 100% 4.950 3.465 N Fgd3 n/a
2 TRCN0000109981 CCAGGTACAAGATATTGTGAA pLKO.1 2173 CDS 100% 4.950 3.465 N Fgd3 n/a
3 TRCN0000109984 CTGTAGGAAGTGCTCAGAGTT pLKO.1 2587 CDS 100% 4.950 3.465 N Fgd3 n/a
4 TRCN0000109982 CCCAACAGAGACAGTGGAATT pLKO.1 1115 CDS 100% 0.000 0.000 N Fgd3 n/a
5 TRCN0000109980 CTGCTATATTTGGCCTGTGTT pLKO.1 3141 3UTR 100% 4.950 2.970 N Fgd3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006516929.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.