Transcript: Mouse XM_006516984.4

PREDICTED: Mus musculus dystrobrevin binding protein 1 (Dtnbp1), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Mus musculus (mouse)
Gene:
Dtnbp1 (94245)
Length:
1012
CDS:
294..884

Additional Resources:

NCBI RefSeq record:
XM_006516984.4
NBCI Gene record:
Dtnbp1 (94245)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006516984.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000197539 CACATTACACACTGACAGAAA pLKO.1 806 CDS 100% 4.950 3.465 N Dtnbp1 n/a
2 TRCN0000278791 CACATTACACACTGACAGAAA pLKO_005 806 CDS 100% 4.950 3.465 N Dtnbp1 n/a
3 TRCN0000176890 GAATGAAATGAGTCTTCAGAT pLKO.1 659 CDS 100% 4.950 3.465 N Dtnbp1 n/a
4 TRCN0000278789 GAATGAAATGAGTCTTCAGAT pLKO_005 659 CDS 100% 4.950 3.465 N Dtnbp1 n/a
5 TRCN0000379485 AGATGGACCTGATGGACATAT pLKO_005 544 CDS 100% 13.200 7.920 N DTNBP1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006516984.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.