Transcript: Mouse XM_006516995.2

PREDICTED: Mus musculus serine/threonine-protein kinase par-1-like (LOC102631805), transcript variant X4, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
LOC102631805 (102631805)
Length:
6127
CDS:
229..3588

Additional Resources:

NCBI RefSeq record:
XM_006516995.2
NBCI Gene record:
LOC102631805 (102631805)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006516995.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000220740 CCACCCTAATATAACCAAATT pLKO.1 441 CDS 100% 13.200 18.480 N Gm272 n/a
2 TRCN0000220742 GCCCAAGATAGGTGATGTTAT pLKO.1 993 CDS 100% 13.200 18.480 N Gm272 n/a
3 TRCN0000220741 CCCATAATACAGCATCGGTAT pLKO.1 3266 CDS 100% 4.050 5.670 N Gm272 n/a
4 TRCN0000220744 CCCATTCAAAGCAACAACATA pLKO.1 861 CDS 100% 5.625 3.938 N Gm272 n/a
5 TRCN0000220743 CCTGACTAAGTGCAGTTCATA pLKO.1 3243 CDS 100% 5.625 3.938 N Gm272 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006516995.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.