Transcript: Mouse XM_006517080.1

PREDICTED: Mus musculus cathepsin L (Ctsl), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ctsl (13039)
Length:
1646
CDS:
340..1344

Additional Resources:

NCBI RefSeq record:
XM_006517080.1
NBCI Gene record:
Ctsl (13039)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006517080.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000030580 GCTTTCCAGTACATTAAGGAA pLKO.1 895 CDS 100% 3.000 2.400 N Ctsl n/a
2 TRCN0000326468 GCTTTCCAGTACATTAAGGAA pLKO_005 895 CDS 100% 3.000 2.400 N Ctsl n/a
3 TRCN0000030582 CAGAAGACTGTATGGCACGAA pLKO.1 447 CDS 100% 2.640 1.848 N Ctsl n/a
4 TRCN0000326395 CAGAAGACTGTATGGCACGAA pLKO_005 447 CDS 100% 2.640 1.848 N Ctsl n/a
5 TRCN0000030581 CCAGTTCTATAGTTCAGGCAT pLKO.1 1107 CDS 100% 2.640 1.848 N Ctsl n/a
6 TRCN0000030579 CCAGCTATCCTGTCGTGAATT pLKO.1 1322 CDS 100% 0.000 0.000 N Ctsl n/a
7 TRCN0000326394 CCAGCTATCCTGTCGTGAATT pLKO_005 1322 CDS 100% 0.000 0.000 N Ctsl n/a
8 TRCN0000030583 AGAAGGACAGATGTTCCTTAA pLKO.1 780 CDS 100% 1.080 0.648 N Ctsl n/a
9 TRCN0000326467 AGAAGGACAGATGTTCCTTAA pLKO_005 780 CDS 100% 1.080 0.648 N Ctsl n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006517080.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.