Transcript: Mouse XM_006517169.3

PREDICTED: Mus musculus ubiquitin interaction motif containing 1 (Uimc1), transcript variant X4, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Uimc1 (20184)
Length:
2338
CDS:
967..2094

Additional Resources:

NCBI RefSeq record:
XM_006517169.3
NBCI Gene record:
Uimc1 (20184)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006517169.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000304713 GCTTTCCGGTCACGAACTAAA pLKO_005 2044 CDS 100% 13.200 18.480 N Uimc1 n/a
2 TRCN0000304712 TGATCGTGTTCATTAAGTATA pLKO_005 2138 3UTR 100% 13.200 18.480 N Uimc1 n/a
3 TRCN0000304765 GGCGATAAGCAGGTTGCTAAT pLKO_005 1366 CDS 100% 10.800 15.120 N Uimc1 n/a
4 TRCN0000125321 CCCACAAAGATTGAACAGCAT pLKO.1 1474 CDS 100% 2.640 3.696 N Uimc1 n/a
5 TRCN0000125320 GCACTCAGAAACCAAGGATTT pLKO.1 1017 CDS 100% 10.800 8.640 N Uimc1 n/a
6 TRCN0000060429 CCATTGCTGAAAGCCTGAATA pLKO.1 784 5UTR 100% 13.200 9.240 N UIMC1 n/a
7 TRCN0000299976 CCATTGCTGAAAGCCTGAATA pLKO_005 784 5UTR 100% 13.200 9.240 N UIMC1 n/a
8 TRCN0000125323 CTGCTGAACTATCTTCACATT pLKO.1 850 5UTR 100% 4.950 3.465 N Uimc1 n/a
9 TRCN0000125319 CCCATTCAGTATCCTGGCTTT pLKO.1 2212 3UTR 100% 4.050 2.835 N Uimc1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006517169.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.