Transcript: Mouse XM_006517282.3

PREDICTED: Mus musculus zinc finger protein 459 (Zfp459), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Zfp459 (328274)
Length:
5500
CDS:
1304..2374

Additional Resources:

NCBI RefSeq record:
XM_006517282.3
NBCI Gene record:
Zfp459 (328274)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006517282.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000095188 GCAAGCCCACTAATTGTGAAT pLKO.1 1821 CDS 100% 4.950 3.960 N Zfp459 n/a
2 TRCN0000095185 CGCTTCTTATGACCCTTCATT pLKO.1 2161 CDS 100% 5.625 3.938 N Zfp459 n/a
3 TRCN0000095186 CCATTACAGCAAGCCCACTAA pLKO.1 1813 CDS 100% 4.950 3.465 N Zfp459 n/a
4 TRCN0000095187 GTATCTAAATCCCTTAAGCAA pLKO.1 2335 CDS 100% 3.000 2.100 N Zfp459 n/a
5 TRCN0000090508 GCTGGCCTCAAACTCAGAAAT pLKO.1 3418 3UTR 100% 13.200 6.600 Y Dync1li1 n/a
6 TRCN0000106535 GCCTGGTCTACAAAGTGAGTT pLKO.1 3891 3UTR 100% 4.950 2.475 Y Gad2 n/a
7 TRCN0000095184 GCCTTGATGATAATAGACTAA pLKO.1 2859 3UTR 100% 4.950 2.475 Y Zfp459 n/a
8 TRCN0000096718 CTGGAGAATTACAGCCACCTT pLKO.1 1664 CDS 100% 2.640 1.320 Y n/a
9 TRCN0000420675 GATGTGATGCTGGAGAATTTC pLKO_005 1655 CDS 100% 13.200 6.600 Y Zfp874a n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006517282.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.