Transcript: Mouse XM_006517321.2

PREDICTED: Mus musculus mitochondrial transcription termination factor 3 (Mterf3), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Mterf3 (66410)
Length:
1899
CDS:
331..1569

Additional Resources:

NCBI RefSeq record:
XM_006517321.2
NBCI Gene record:
Mterf3 (66410)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006517321.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000240993 GATAACCAGCTGGGACCATTT pLKO_005 919 CDS 100% 10.800 15.120 N Mterf3 n/a
2 TRCN0000182993 CTTTGGACAAGTTCGTATCTT pLKO.1 1472 CDS 100% 5.625 7.875 N Mterf3 n/a
3 TRCN0000240991 TCGCCTTCCAAGGCTACTAAC pLKO_005 1158 CDS 100% 10.800 8.640 N Mterf3 n/a
4 TRCN0000217115 CAGACGGTTCAACTCAGTTAA pLKO.1 357 CDS 100% 13.200 9.240 N Mterf3 n/a
5 TRCN0000240990 TCCATTCTGCCAGCACAAATA pLKO_005 536 CDS 100% 13.200 9.240 N Mterf3 n/a
6 TRCN0000240994 ACAGCAGGAGAGGATACTTAG pLKO_005 603 CDS 100% 10.800 7.560 N Mterf3 n/a
7 TRCN0000240992 ACCACATCATCGTCAAGTTTC pLKO_005 1349 CDS 100% 10.800 7.560 N Mterf3 n/a
8 TRCN0000216499 CATTAAGCAAATACTGCTATT pLKO.1 876 CDS 100% 10.800 7.560 N Mterf3 n/a
9 TRCN0000215884 CTTAAGACCAGAGTAGCTTAT pLKO.1 982 CDS 100% 10.800 7.560 N Mterf3 n/a
10 TRCN0000183081 CAGAAAGAACTTGAACTGAAT pLKO.1 1111 CDS 100% 4.950 3.465 N Mterf3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006517321.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.