Transcript: Mouse XM_006517422.3

PREDICTED: Mus musculus centrosomal protein 72 (Cep72), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Cep72 (74470)
Length:
3165
CDS:
54..1817

Additional Resources:

NCBI RefSeq record:
XM_006517422.3
NBCI Gene record:
Cep72 (74470)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006517422.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000248827 CTGGCTGAACTTCGATCTTTA pLKO_005 129 CDS 100% 13.200 18.480 N Cep72 n/a
2 TRCN0000248829 TGGTTAGCCTTGAGGGTATAC pLKO_005 247 CDS 100% 10.800 15.120 N Cep72 n/a
3 TRCN0000257823 ATGACAGCAGAGCTCAATAAT pLKO_005 1377 CDS 100% 15.000 10.500 N Cep72 n/a
4 TRCN0000215396 CTTCATTAGCAGAAGTATTTA pLKO.1 316 CDS 100% 15.000 10.500 N Cep72 n/a
5 TRCN0000248828 GGAAGAGAATAGCCACTTAAA pLKO_005 1445 CDS 100% 13.200 9.240 N Cep72 n/a
6 TRCN0000182339 GCTGAGCAACAGCAACAGTAT pLKO.1 1338 CDS 100% 4.950 3.465 N Cep72 n/a
7 TRCN0000200341 GAACATGAAGCTGACCTCCAT pLKO.1 711 CDS 100% 2.640 1.848 N Cep72 n/a
8 TRCN0000257807 GTACCTGGGCATGCATCTATC pLKO_005 1864 3UTR 100% 0.000 0.000 N Cep72 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006517422.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.