Transcript: Mouse XM_006517446.2

PREDICTED: Mus musculus spermatogenesis associated 9 (Spata9), transcript variant X5, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Spata9 (75571)
Length:
1068
CDS:
278..850

Additional Resources:

NCBI RefSeq record:
XM_006517446.2
NBCI Gene record:
Spata9 (75571)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006517446.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000248539 GGACGCTCATTCAAGGGTTAA pLKO_005 309 CDS 100% 10.800 15.120 N Spata9 n/a
2 TRCN0000248538 TTCTTATGCAGCACTAATTTA pLKO_005 541 CDS 100% 15.000 10.500 N Spata9 n/a
3 TRCN0000248541 ACAAACACAAATACCACTTTA pLKO_005 856 3UTR 100% 13.200 9.240 N Spata9 n/a
4 TRCN0000248540 ATGCGGTGCTGGCAAAGATAA pLKO_005 579 CDS 100% 13.200 9.240 N Spata9 n/a
5 TRCN0000191682 GAGTGCTCAATAGTTATCTAT pLKO.1 877 3UTR 100% 5.625 3.938 N Spata9 n/a
6 TRCN0000189749 GAAGTGAATGTGGCGAGTCAA pLKO.1 431 CDS 100% 4.950 3.465 N Spata9 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006517446.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.