Transcript: Mouse XM_006517516.2

PREDICTED: Mus musculus a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 6 (Adamts6), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Mus musculus (mouse)
Gene:
Adamts6 (108154)
Length:
8080
CDS:
2874..5090

Additional Resources:

NCBI RefSeq record:
XM_006517516.2
NBCI Gene record:
Adamts6 (108154)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006517516.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000254944 ATTATAGTGGCTCGCTTAATT pLKO_005 2771 5UTR 100% 15.000 21.000 N Adamts6 n/a
2 TRCN0000267509 ACCGAGACTCCTTCGTGTTTA pLKO_005 5969 3UTR 100% 13.200 18.480 N Adamts6 n/a
3 TRCN0000051256 CCTGACTTATCTTGAACACTA pLKO.1 1982 5UTR 100% 4.950 6.930 N ADAMTS6 n/a
4 TRCN0000254942 ATATGATATCTGCACGTATAA pLKO_005 2810 5UTR 100% 13.200 10.560 N Adamts6 n/a
5 TRCN0000254945 ATCATGGCCTCATCGGAATTT pLKO_005 1920 5UTR 100% 13.200 10.560 N Adamts6 n/a
6 TRCN0000254943 TGTTGGATTGCATGGTATTAT pLKO_005 2330 5UTR 100% 15.000 10.500 N Adamts6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006517516.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.