Transcript: Mouse XM_006517542.2

PREDICTED: Mus musculus mutS homolog 3 (Msh3), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Msh3 (17686)
Length:
3702
CDS:
449..3148

Additional Resources:

NCBI RefSeq record:
XM_006517542.2
NBCI Gene record:
Msh3 (17686)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006517542.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000175576 CCGTTAGAACTGCAGTACTTA pLKO.1 425 5UTR 100% 5.625 7.875 N Msh3 n/a
2 TRCN0000193878 CCGCTCTTTATACGAAATCCA pLKO.1 726 CDS 100% 3.000 4.200 N Msh3 n/a
3 TRCN0000216018 CTGTATCAGGACAAGAGTTTA pLKO.1 1971 CDS 100% 13.200 9.240 N Msh3 n/a
4 TRCN0000217687 GGTTCTTGGTGCCTACATTAT pLKO.1 3396 3UTR 100% 13.200 9.240 N Msh3 n/a
5 TRCN0000215772 CAGAGAACTGAAGATTCAAAC pLKO.1 3178 3UTR 100% 10.800 7.560 N Msh3 n/a
6 TRCN0000175525 CCAGAAGACTTCCGATTGTAA pLKO.1 370 5UTR 100% 5.625 3.938 N Msh3 n/a
7 TRCN0000194588 CTTCGGGAGAGACTTGAAGTT pLKO.1 224 5UTR 100% 4.950 3.465 N Msh3 n/a
8 TRCN0000193285 CTTCTGTGTATCTACGAAGAA pLKO.1 836 CDS 100% 4.950 3.465 N Msh3 n/a
9 TRCN0000174683 GAGTTGTGAAGCAAACTGAAA pLKO.1 648 CDS 100% 4.950 3.465 N Msh3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006517542.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.